Marco abierto de lectura

De Wikipedia, la enciclopedia libre
Saltar a: navegación, búsqueda
Esquema de un marco abierto de lectura, que incluye el codón de inicio (o start) y de parada (o stop).

En genética se llama marco abierto de lectura (siglas ORF del inglés Open reading frame) a la secuencia de ARN comprendida entre un codón de inicio (AUG) de la traducción y un codón de terminación, descontando las secuencias que corresponden a los intrones en caso de haberlas. Se encuentra acotado por los UTRs, o secuencias no traducidas. El nombre se debe a que, una vez establecido uno de los tres posibles marcos de lectura por el codón de iniciación, la secuencia se encuentra "abierta" para la traducción porque carece de codón de terminación.

El mARN contiene por lo menos un ORF, los eucariotas por lo general tienen uno solo, mientras que los procariotas suelen tener dos o más, por lo tanto pueden sintetizar varios polipéptidos. Los ARN mensajeros que contienen más de un ORF se conocen como ARN policistrónico y aquellos con uno solo monocistrónico.

En una secuencia de ADN cualquiera hay, a priori, 6 posibles sentidos en los que pueden aparecer marcos abiertos de lectura; dado que cada codón toma 3 nucleótidos, existen 3 posibles lugares de inicio para tomar los nucleótidos de 3 en 3, si se tomara un cuarto nucleótido como lugar de inicio, haría coincidir el marco abierto de lectura con el mismo que si se toma el primer nucleótido. A lo que hay que sumar los otros 3 posibles marcos abiertos de lectura si el ADN es traducido tomando como molde la hebra complementaria, dando el sentido de lectura opuesto.

Estos marcos abiertos de lectura se denominan +1, +2, +3, -1, -2 y -3.

En un ejemplo con la secuencia 5' aactgcagtacgtaacgtca 3'

+3 5'   a act gca gta cgt aac gtc a 3'
+2 5'  aa ctg cag tac gta acg tca   3'
+1 5' aac tgc agt acg taa cgt ca    3'
-1 3' ttg acg tca tgc att gca gt    5'
-2 3'  tt gac gtc atg cat tgc agt   5'
-3 3'   t tga cgt cat gca ttg cag t 5'

Cada uno de los 6 posibles marcos abiertos de lectura dará lugar a una secuencia proteica absolutamente diferente.

Véase también[editar]

Enlaces externos[editar]

  • StarORF Una multi-plataforma, basada en Java, la herramienta de interfaz gráfica de usuario para predecir y analizar ORFs y la obtención de revertir secuencia del complemento.