Anexo:Endonucleasas homing de restricción

De Wikipedia, la enciclopedia libre
Saltar a: navegación, búsqueda
Leyenda de bases nitrogenadas
Código Nucleótido representado
A Adenina (A)
C Citosina (C)
G Guanina (G)
T Timina (T)
N A, C, G or T
M A or C
R A or G
W A or T
Y C or T
S C or G
K G or T
H A, C or T
B C, G or T
V A, C or G
D A, G or T

Las endonucleasas homing son un tipo especial de enzimas de restricción codificadas por intrones o inteínas, que actúan sobre el DNA de la propia célula que las sintetiza.[1]

Para más información, consultar el artículo principal endonucleasas homing.

Lista de endonucleasas homing de restricción[editar]

En esta lista se incluyen algunos de los ejemplos más estudiados, detallándose los siguientes conceptos:

  • Enzima: Nombre de la enzima, según la nomenclatura aceptada y adoptada internacionalmente; y referencias bibliográficas correspondientes. (Para más detalles, consultar la sección Nomenclatura del artículo endonucleasas homing.)
  • SF: Familia estructural: una de las cuatro familias determinadas para esta clase de proteínas, en base a sus motivos compartidos: HI: familia LAGLIDADG – HII: familia GIY-YIG – HIII: familia H-N-H – HIV: familia His-Cys box. (Para más detalles, consultar la sección Familias estructurales del artículo endonucleasas homing.)
  • Código PDB: Código empleado para identificar la estructura de la proteína en la base de datos «PDB».
  • Origen: Organismo que genera la enzima de forma natural (o bien artificialmente si la enzima es sintética).
  • D: Dominio biológico del organismo origen: A: arqueas – B: bacterias – E: eucariotas.
  • LSC: Localización subcelular: cloro: cloroplastidial – crm: cromosomal – mito: mitocondrial – nuclear: nuclear extracromosomal – fago: bacteriofago.
  • Secuencia de reconocimiento: Secuencia de DNA que la enzima reconoce y a la que se une específicamente.
  • Secuencia de corte: Secuencia de corte y producto del corte. Normalmente la secuencia de reconocimiento y la de corte coinciden, pero en algunos casos esta última puede encontrarse docenas de nucleótidos alejada de la primera.


Enzima SF Código PDB Origen D LSC Secuencia de reconocimiento Secuencia de corte
I-AniI[2] HI 1P8K Aspergillus nidulans E mito 5' TTGAGGAGGTTTCTCTGTAAATAA
3' AACTCCTCCAAAGAGACATTTATT
5' ---TTGAGGAGGTTTC   TCTGTAAATAA--- 3'
3' ---AACTCCTCC   AAAGAGACATTTATT--- 5'
I-CeuI[3] [4] [5] [6] HI 2EX5 Chlamydomonas eugametos E cloro 5' TAACTATAACGGTCCTAAGGTAGCGA
3' ATTGATATTGCCAGGATTCCATCGCT
5' ---TAACTATAACGGTCCTAA   GGTAGCGA--- 3'
3' ---ATTGATATTGCCAG   GATTCCATCGCT--- 5'
I-ChuI[7] [8] HI Chlamydomonas humicola E cloro 5' GAAGGTTTGGCACCTCGATGTCGGCTCATC
3' CTTCCAAACCGTGGAGCTACAGCCGAGTAG
5' ---GAAGGTTTGGCACCTCG   ATGTCGGCTCATC--- 3'
3' ---CTTCCAAACCGTG   GAGCTACAGCCGAGTAG--- 5'
I-CpaI[8] [9] HI Chlamydomonas pallidostigmata E cloro 5' CGATCCTAAGGTAGCGAAATTCA
3' GCTAGGATTCCATCGCTTTAAGT
5' ---CGATCCTAAGGTAGCGAA   ATTCA--- 3'
3' ---GCTAGGATTCCATC   GCTTTAAGT--- 5'
I-CpaII[10] HI Chlamydomonas pallidostigmata E cloro 5' CCCGGCTAACTCTGTGCCAG
3' GGGCCGATTGAGACACGGTC
5' ---CCCGGCTAACTC   TGTGCCAG--- 3'
5' ---GGGCCGAT   TGAGACACGGTC--- 3'
I-CreI[11] HI 1BP7 Chlamydomonas reinhardtii E cloro 5' CTGGGTTCAAAACGTCGTGAGACAGTTTGG
3' GACCCAAGTTTTGCAGCACTCTGTCAAACC
5' ---CTGGGTTCAAAACGTCGTGA   GACAGTTTGG--- 3'
3' ---GACCCAAGTTTTGCAG   CACTCTGTCAAACC--- 5'
I-DmoI HI 1B24 Desulfurococcus mobilis A crm 5' ATGCCTTGCCGGGTAAGTTCCGGCGCGCAT
3' TACGGAACGGCCCATTCAAGGCCGCGCGTA
5' ---ATGCCTTGCCGGGTAA   GTTCCGGCGCGCAT--- 3'
3' ---TACGGAACGGCC   CATTCAAGGCCGCGCGTA--- 5'
H-DreI[12] 1MOW Escherichia coli pI-DreI B 5' CAAAACGTCGTAAGTTCCGGCGCG
3' GTTTTGCAGCATTCAAGGCCGCGC
5' ---CAAAACGTCGTAA   GTTCCGGCGCG--- 3'
3' ---GTTTTGCAG   CATTCAAGGCCGCGC--- 5'
I-HmuI[13] [14] HIII 1U3E Bacillus subtilis fago SPO1 B fago 5' AGTAATGAGCCTAACGCTCAGCAA
3' TCATTACTCGGATTGCGAGTCGTT
  Endonucleasa que corta en una sola hebra del DNA: *
  3' ---TCATTACTCGGATTGC   GAGTCGTT--- 5'
I-HmuII[14] [15] HIII Bacillus subtilis fago SP82 B fago 5' AGTAATGAGCCTAACGCTCAACAA
3' TCATTACTCGGATTGCGAGTTGTT
  Endonucleasa que corta en una sola hebra del DNA: *
  3' ---TCATTACTCGGATTGCGAGTTGTTN35   NNNN--- 5'
I-LlaI[16] [17] HIII Lactococcus lactis B crm 5' CACATCCATAACCATATCATTTTT
3' GTGTAGGTATTGGTATAGTAAAAA
5' ---CACATCCATAA   CCATATCATTTTT--- 3'
3' ---GTGTAGGTATTGGTATAGTAA   AAA--- 5'
I-MsoI 1M5X Monomastix sp. E 5' CTGGGTTCAAAACGTCGTGAGACAGTTTGG
3' GACCCAAGTTTTGCAGCACTCTGTCAAACC
5' ---CTGGGTTCAAAACGTCGTGA   GACAGTTTGG--- 3'
3' ---GACCCAAGTTTTGCAG   CACTCTGTCAAACC--- 5'
PI-PfuI 1DQ3 Pyrococcus furiosus Vc1 A 5' GAAGATGGGAGGAGGGACCGGACTCAACTT
3' CTTCTACCCTCCTCCCTGGCCTGAGTTGAA
5' ---GAAGATGGGAGGAGGG   ACCGGACTCAACTT--- 3'
3' ---CTTCTACCCTCC   TCCCTGGCCTGAGTTGAA--- 5'
PI-PkoII 2CW7 Pyrococcus kodakaraensis KOD1 A 5' CAGTACTACGGTTAC
3' GTCATGATGCCAATG
5' ---CAGTACTACG  GTTAC--- 3'
3' ---GTCATG  ATGCCAATG--- 5'
I-PorI[18] [19] HIII Pyrobaculum organotrophum A crm 5' GCGAGCCCGTAAGGGTGTGTACGGG
3' CGCTCGGGCATTCCCACACATGCCC
5' ---GCGAGCCCGTAAGGGT   GTGTACGGG--- 3'
3' ---CGCTCGGGCATT   CCCACACATGCCC--- 5'
I-PpoI HIV 1EVX Physarum polycephalum E nuclear 5' TAACTATGACTCTCTTAAGGTAGCCAAAT
3' ATTGATACTGAGAGAATTCCATCGGTTTA
5' ---TAACTATGACTCTCTTAA   GGTAGCCAAAT--- 3'
3' ---ATTGATACTGAGAG   AATTCCATCGGTTTA--- 5'
PI-PspI HI Pyrococcus sp. A crm 5' TGGCAAACAGCTATTATGGGTATTATGGGT
3' ACCGTTTGTCGATAATACCCATAATACCCA
5' ---TGGCAAACAGCTATTAT   GGGTATTATGGGT--- 3'
3' ---ACCGTTTGTCGAT   AATACCCATAATACCCA--- 5'
I-ScaI[20] [21] HI Saccharomyces capensis E mito 5' TGTCACATTGAGGTGCACTAGTTATTAC
3' ACAGTGTAACTCCACGTGATCAATAATG
5' ---TGTCACATTGAGGTGCACT   AGTTATTAC--- 3'
3' ---ACAGTGTAACTCCAC   GTGATCAATAATG--- 5'
I-SceI[4] [5] HI 1R7M Saccharomyces cerevisiae E mito 5' AGTTACGCTAGGGATAACAGGGTAATATAG
3' TCAATGCGATCCCTATTGTCCCATTATATC
5' ---AGTTACGCTAGGGATAA   CAGGGTAATATAG--- 3'
3' ---TCAATGCGATCCC   TATTGTCCCATTATATC--- 5'
PI-SceI[22] [23] HI 1VDE Saccharomyces cerevisiae E 5' ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCA
3' TAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGT
5' ---ATCTATGTCGGGTGC   GGAGAAAGAGGTAATGAAATGGCA--- 3'
3' ---TAGATACAGCC   CACGCCTCTTTCTCCATTACTTTACCGT--- 5'
I-SceII[24] [25] [26] HI Saccharomyces cerevisiae E mito 5' TTTTGATTCTTTGGTCACCCTGAAGTATA
3' AAAACTAAGAAACCAGTGGGACTTCATAT
5' ---TTTTGATTCTTTGGTCACCC   TGAAGTATA--- 3'
3' ---AAAACTAAGAAACCAG   TGGGACTTCATAT--- 5'
I-SecIII[24] [27] [28] HI Saccharomyces cerevisiae E mito 5' ATTGGAGGTTTTGGTAACTATTTATTACC
3' TAACCTCCAAAACCATTGATAAATAATGG
5' ---ATTGGAGGTTTTGGTAAC   TATTTATTACC--- 3'
3' ---TAACCTCCAAAACC   ATTGATAAATAATGG--- 5'
I-SceIV[24] [29] [30] HI Saccharomyces cerevisiae E mito 5' TCTTTTCTCTTGATTAGCCCTAATCTACG
3' AGAAAAGAGAACTAATCGGGATTAGATGC
5' ---TCTTTTCTCTTGATTA   GCCCTAATCTACG--- 3'
3' ---AGAAAAGAGAAC   TAATCGGGATTAGATGC--- 5'
I-SceV[24] [31] HIII Saccharomyces cerevisiae E mito 5' AATAATTTTCTTCTTAGTAATGCC
3' TTATTAAAAGAAGAATCATTACGG
5' ---AATAATTTTCT   TCTTAGTAATGCC--- 3'
3' ---TTATTAAAAGAAGAATCATTA   CGG--- 5'
I-SceVI[24] [32] HIII Saccharomyces cerevisiae E mito 5' GTTATTTAATGTTTTAGTAGTTGG
3' CAATAAATTACAAAATCATCAACC
5' ---GTTATTTAATG   TTTTAGTAGTTGG--- 3'
3' ---CAATAAATTACAAAATCATCA   ACC--- 5'
I-SceVII[20] HI Saccharomyces cerevisiae E mito 5' TGTCACATTGAGGTGCACTAGTTATTAC
3' ACAGTGTAACTCCACGTGATCAATAATG
  Desconocida **
I-Ssp6803I 2OST Synechocystis sp. PCC 6803 B 5' GTCGGGCTCATAACCCGAA
3' CAGCCCGAGTATTGGGCTT
5' ---GTCGGGCT   CATAACCCGAA--- 3'
3' ---CAGCCCGAGTA   TTGGGCTT--- 5'
I-TevI[33] [34] [35] HII 1I3J Escherichia coli fago T4 B fago 5' AGTGGTATCAACGCTCAGTAGATG
3' TCACCATAGT TGCGAGTCATCTAC
5' ---AGTGGTATCAAC   GCTCAGTAGATG--- 3'
3' ---TCACCATAGT   TGCGAGTCATCTAC--- 5'
I-TevII[33] [36] HII Escherichia coli fago T4 B fago 5' GCTTATGAGTATGAAGTGAACACGTTATTC
3' CGAATACTCATACTTCACTTGTGCAATAAG
5' ---GCTTATGAGTATGAAGTGAACACGT   TATTC--- 3'
3' ---CGAATACTCATACTTCACTTGTG   CAATAAG--- 5'
I-TevIII[37] HIII Escherichia coli fago RB3 B fago 5' TATGTATCTTTTGCGTGTACCTTTAACTTC
3' ATACATAGAAAACGCACATGGAAATTGAAG
5' ---T   ATGTATCTTTTGCGTGTACCTTTAACTTC--- 3'
3' ---AT   ACATAGAAAACGCACATGGAAATTGAAG--- 5'
PI-TliI[38] [39] HI Thermococcus litoralis A crm 5' TAYGCNGAYACNGACGGYTTYT
3' ATRCGNCTRTGNCTGCCTAARA
5' ---TAYGCNGAYACNGACGG   YTTYT--- 3'
3' ---ATRCGNCTRTGNC   TGCCTAARA--- 5'
PI-TliII[40] [22] [39] HI Thermococcus litoralis A crm 5' AAATTGCTTGCAAACAGCTATTACGGCTAT
3' TTTAACGAACGTTTGTCGATAATGCCGATA
  Desconocida **
I-Tsp061I 2DCH Thermoproteus sp. IC-061 A 5' CTTCAGTATGCCCCGAAAC
3' GAAGTCATACGGGGCTTTG
5' ---CTTCAGTAT   GCCCCGAAAC--- 3'
3' ---GAAGT   CATACGGGGCTTTG--- 5'
I-Vdi141I 3E54 Vulcanisaeta distributa IC-141 A 5' CCTGACTCTCTTAAGGTAGCCAAA
3' GGACTGAGAGAATTCCATCGGTTT
5' ---CCTGACTCTCTTAA   GGTAGCCAAA--- 3'
3' ---GGACTGAG   AGAATTCCATCGGTTT--- 5'


*: Endonucleasa que corta en una sola hebra de DNA: Estas enzimas cortan sólo una de las dos hebras del DNA, dejando la otra intacta. Se las podría denominar "endonucleasas pellizcadoras", de su denominación original anglosajona "nicking endonuclease".
**: Secuencia de corte desconocida: La investigación acerca de esta enzima no ha conseguido revelar aún su secuencia de corte concreta.

Enlaces externos[editar]

Bases de datos y listas de enzimas de restricción:

  • Base de datos exhaustiva de enzimas de restricción y endonucleasas homing ubicada en los servidores de New England Biolabs©. Incluye toda clase de información biológica, estructural, cinética y comercial acerca de miles de enzimas. También incluye referencias bibliográficas especializadas para cada molécula: Roberts RJ, Vincze T, Posfai, J, Macelis D. «REBASE». Consultado el 07-01-2010. «Restriction Enzyme Database.».
  • Base de datos de inteínas, alojada en la página web de New England Biolabs©. Perler FB. «InBase». Consultado el 05-02-2010. «The Intein Database and Registry»..[41]
  • Información detallada para experimentos bioquímicos: «Enzyme finder». Consultado el 07-01-2010. «New England Biolabs© enzyme finder.».

Bases de datos de proteínas:

  • Base de datos de estructuras de proteínas, resueltas a estructura atómica: «PDB». Research Collaboratory for Structural Bioinformatics (RCSB). Consultado el 25-01-2010. «RCSB Protein Data Bank.».
  • Bases de datos generales de proteínas: Swiss Institute of Bioinformatics (SIB) & European Bioinformatics Institute (EBI). «UniProtKB/Swiss-Prot & TrEMBL». Consultado el 25-01-2010. «Swiss-Prot es una base de datos de proteínas con un gran nivel de supervisión y anotación, un mínimo nivel de redundancia y un elevado nivel de integración con otras bases de datos. Swiss-Prot describe, tanto la función de la proteína, como su estructura de dominios, modificaciones post-transcripcionales, variantes, etc. TrEMBL es un suplemento a Swiss-Prot, anotado de forma automatizada, que contiene todas las traducciones de las entradas recogidas en las bases de datos del EMBL que no han sido aún integradas en Swiss-Prot.».

Referencias[editar]

  1. Lambowitz AM, Belfort M (1993). «Introns as mobile genetic elements». Annu Rev Biochem. 62:  pp. 587–622. 
  2. Naito T, Kusano K, Kobayashi I (February 1995). «Selfish behavior of restriction-modification systems». Science 267 (5199):  pp. 897–99. doi:10.1126/science.7846533. PMID 7846533. 
  3. Jacquier A, Dujon B (June 1985). «An intron-encoded protein is active in a gene conversion process that spreads an intron into a mitochondrial gene». Cell 42 (2):  pp. 383–94. doi:10.1016/S0092-8674(85)80011-8. PMID 3886163. 
  4. a b Gauthier A, Turmel M, Lemieux C (January 1991). «A group I intron in the chloroplast large subunit rRNA gene of Chlamydomonas eugametos encodes a double-strand endonuclease that cleaves the homing site of this intron». Curr Genet 19 (1):  pp. 43–47. doi:10.1007/BF00362086. PMID 2036685. 
  5. a b Marshall P, Lemieux C (August 1991). «Cleavage pattern of the homing endonuclease encoded by the fifth intron in the chloroplast large subunit rRNA-encoding gene of Chlamydomonas eugametos». Gene 104 (2):  pp. 241–5. doi:10.1016/0378-1119(91)90256-B. PMID 1916294. 
  6. Turmel M, Boulanger J, Schnare MN, Gray MW, Lemieux C (March 1991). «Six group I introns and three internal transcribed spacers in the chloroplast large subunit ribosomal RNA gene of the green alga Chlamydomonas eugametos». J Mol Biol 218 (2):  pp. 293–311. doi:10.1016/0022-2836(91)90713-G. PMID 1849178. 
  7. Côté V, Mercier JP, Lemieux C, Turmel M (July 1993). «The single group-I intron in the chloroplast rrnL gene of Chlamydomonas humicola encodes a site-specific DNA endonuclease (I-ChuI)». Gene 129 (1):  pp. 69–76. doi:10.1016/0378-1119(93)90697-2. PMID 8335261. 
  8. a b Turmel M, Gutell RR, Mercier JP, Otis C, Lemieux C (July 1993). «Analysis of the chloroplast large subunit ribosomal RNA gene from 17 Chlamydomonas taxa. Three internal transcribed spacers and 12 group I intron insertion sites». J Mol Biol 232 (2):  pp. 446-67. doi:10.1006/jmbi.1993.1402. PMID 8393936. 
  9. Turmel M, Côté V, Otis C, Mercier JP, Gray MW, Lonergan KM, Lemieux C (July 1995). «Evolutionary transfer of ORF-containing group I introns between different subcellular compartments (chloroplast and mitochondrion)». Mol Biol Evol 12 (4):  pp. 533-45. PMID 7659010. 
  10. Turmel M, Mercier JP, Côté V, Otis C, Lemieux C (July 1995). «The site-specific DNA endonuclease encoded by a group I intron in the Chlamydomonas pallidostigmatica chloroplast small subunit rRNA gene introduces a single-strand break at low concentrations of Mg2+». Nucleic Acids Res 23 (13):  pp. 2519–25. doi:10.1093/nar/23.13.2519. PMID 7630730. 
  11. Jurica MS, Monnat RJ, Stoddard BL (October 1998). «DNA recognition and cleavage by the LAGLIDADG homing endonuclease I-CreI». Moll Cell 2 (4):  pp. 469-76. doi:10.1016/0092-8674(95)90092-6. PMID 9809068. 
  12. Chevalier BS, Kortemme T, Chadsey MS, Baker D, Monnat RJ, Stoddard BL (October 2002). «Design, activity, and structure of a highly specific artificial endonuclease». Moll Cell 10 (4):  pp. 895-905. doi:10.1016/S1097-2765(02)00690-1. PMID 12419232. 
  13. Goodrich-Blair H, Scarlato V, Gott JM, Xu M, Shub DA (October 1990). «A self-splicing group I intron in the DNA polymerase gene of Bacillus subtilis bacteriophage SPO1». Cell 63 (2):  pp. 417-24. doi:10.1016/0092-8674(90)90174-D. PMID 2119891. 
  14. a b Goodrich-Blair H, Shub DA (January 1996). «Beyond homing: competition between intron endonucleases confers a selective advantage on flanking genetic markers». Cell 84 (2):  pp. 211-21. doi:10.1016/S0092-8674(00)80976-9. PMID 8565067. 
  15. Goodrich-Blair H, Shub DA (September 1994). «The DNA polymerase genes of several HMU-bacteriophages have similar group I introns with highly divergent open reading frames». Nucleic Acids Res 22 (18):  pp. 3715-21. doi:10.1093/nar/22.18.3715. PMID 7937082. 
  16. Shearman C, Godon JJ, Gasson M (July 1996). «Splicing of a group II intron in a functional transfer gene of Lactococcus lactis.». Mol Microbiol 21 (1):  pp. 45-53. PMID 8843433. 
  17. Mills DA, McKay LL, Dunny GM (June 1996). «Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci». J Bacteriol 178 (12):  pp. 3531-8. PMID 8655550. 
  18. Lykke-Andersen J, Thi-Ngoc HP, Garrett RA (November 1994). «DNA substrate specificity and cleavage kinetics of an archaeal homing-type endonuclease from Pyrobaculum organotrophum». Nucleic Acids Res 22 (22):  pp. 4583-90. doi:10.1093/nar/22.22.4583. PMID 7984405. 
  19. Dalgaard JZ, Garrett RA (November 1992). «Protein-coding introns from the 23S rRNA-encoding gene form stable circles in the hyperthermophilic archaeon Pyrobaculum organotrophum». Gene 121 (1):  pp. 103-10. doi:10.1016/0378-1119(92)90167-N. PMID 1427083. 
  20. a b Szczepanek T, Lazowska J (July 1996). «Replacement of two non-adjacent amino acids in the S.cerevisiae bi2 intron-encoded RNA maturase is sufficient to gain a homing-endonuclease activity». EMBO J 15 (14):  pp. 3758-67. PMID 8670880. 
  21. Lazowska J, Szczepanek T, Macadre C, Dokova M (1992). «Two homologous mitochondrial introns from closely related Saccharomyces species differ by only a few amino acid replacements in their Open Reading Frames: one is mobile, the other is not». C R Acad Sci Paris 315 (2):  pp. 37-41. PMID 1330224. 
  22. a b Kane PM, Yamashiro CT, Wolczyk DF, Neff N, Goebl M, Stevens TH (November 1990). «Protein splicing converts the yeast TFP1 gene product to the 69-kD subunit of the vacuolar H(+)-adenosine triphosphatase». Science 250 (4981):  pp. 651-7. doi:10.1126/science.2146742. PMID 2146742. 
  23. Gimble FS, Thorner J (May 1992). «Homing of a DNA endonuclease gene by meiotic gene conversion in Saccharomyces cerevisiae». Nature 357 (6376):  pp. 301–6. doi:10.1038/357301a0. PMID 1534148. 
  24. a b c d e Bonitz SG, Coruzzi G, Thalenfeld BE, Tzagoloff A, Macino G (December 1980). «Assembly of the mitochondrial membrane system. Structure and nucleotide sequence of the gene coding for subunit 1 of yeast cytochrme oxidase». J Biol Chem 255 (24):  pp. 11927-41. PMID 6254986. 
  25. Hanson DK, Lamb MR, Mahler HR, Perlman PS (March 1982). «Evidence for translated intervening sequences in the mitochondrial genome of Saccharomyces cerevisiae». J Biol Chem 257 (6):  pp. 3218-24. PMID 6277926. 
  26. Delahodde A, Goguel V, Becam AM, Creusot F, Perea J, Banroques J, Jacq C (February 1989). «Site-specific DNA endonuclease and RNA maturase activities of two homologous intron-encoded proteins from yeast mitochondria». Cell 56 (3):  pp. 431-41. doi:10.1016/0092-8674(89)90246-8. PMID 2536593. 
  27. Sargueil B, Delahodde A, Hatat D, Tian GL, Lazowska J, Jacq C (February 1991). «A new specific DNA endonuclease activity in yeast mitochondria». Mol Gen Genet 225 (2):  pp. 340-1. doi:10.1007/BF00269867. PMID 1848651. 
  28. Perea J, Desdouets C, Schapria M, Jacq C (January 1993). «I-Sce III: a novel group I intron-encoded endonuclease from the yeast mitochondria». Nucleic Acids Res 21 (2):  pp. 358. doi:10.1093/nar/21.2.358. PMID 8441645. 
  29. Moran JV, Wernette CM, Mecklenburg KL, Butow RA, Perlman PS (August 1992). «Intron 5 alpha of the COXI gene of yeast mitochondrial DNA is a mobile group I intron». Nucleic Acids Res 20 (15):  pp. 4069-76. doi:10.1093/nar/20.15.4069. PMID 1324475. 
  30. Seraphin B, Faye G, Hatat D, Jacq C (April 1992). «The yeast mitochondrial intron aI5 alpha: associated endonuclease activity and in vivo mobility». Gene 113 (1):  pp. 1-8. doi:10.1016/0378-1119(92)90663-A. PMID 1314207. 
  31. Liang F, Romanienko PJ, Weaver DT, Jeggo PA, Jasin M (August 1996). «Chromosomal double-strand break repair in Ku80-deficient cells». PNAS 93 (17):  pp. 8929-33. doi:10.1073/pnas.93.17.8929. PMID 8799130. 
  32. Yang J, Zimmerly S, Perlman PS, Lambowitz AM (May 1996). «Efficient integration of an intron RNA into double-stranded DNA by reverse splicing». Nature 381 (6580):  pp. 332-5. doi:10.1038/381332a0. PMID 8692273. 
  33. a b Bell-Pedersen D, Quirk S, Clyman J, Belfort M (July 1990). «Intron mobility in phage T4 is dependent upon a distinctive class of endonucleases and independent of DNA sequences encoding the intron core: mechanistic and evolutionary implications». Nucleic Acids Res 18 (13):  pp. 3763-70. doi:10.1093/nar/18.13.3763. PMID 2165250. 
  34. Chu FK, Maley G, Pedersen-Lane J, Wang AM, Maley F (May 1990). «Characterization of the restriction site of a prokaryotic intron-encoded endonuclease». PNAS 87 (9):  pp. 3574-8. doi:10.1073/pnas.87.9.3574. PMID 2159153. 
  35. Bell-Pedersen D, Quirk SM, Aubrey M, Belfort M (October 1989). «A site-specific endonuclease and co-conversion of flanking exons associated with the mobile td intron of phage T4». Gene 82 (1):  pp. 119-26. doi:10.1016/0378-1119(89)90036-X. PMID 2555262. 
  36. Shub DA, Gott JM, Xu MQ, Lang BF, Michel F, Tomaschewski J, Pedersen-Lane J, Belfort M (February 1988). «Structural conservation among three homologous introns of bacteriophage T4 and the group I introns of eukaryotes». PNAS 85 (4):  pp. 1151-5. doi:10.1073/pnas.85.4.1151. PMID 3422485. 
  37. Eddy SR, Gold L (June 1991). «The phage T4 nrdB intron: a deletion mutant of a version found in the wild». Genes Dev 5 (6):  pp. 1032-41. doi:10.1101/gad.5.6.1032. PMID 2044951. 
  38. Xu M, Southworth MW, Mersha FB, Hornstra LJ, Perler FB (December 1993). «In vitro protein splicing of purified precursor and the identification of a branched intermediate». Cell 75 (7):  pp. 1371-7. doi:10.1016/0092-8674(93)90623-X. PMID 8269515. 
  39. a b Perler FB, Comb DG, Jack WE, Moran LS, Qiang B, Kucera RB, Benner J, Slatko BE, Nwankwo DO, Hempstead SK, Carlow CKS, Jannasch H (June 1992). «Intervening sequences in an Archaea DNA polymerase gene». PNAS 89 (12):  pp. 5577-81. doi:10.1073/pnas.89.12.5577. PMID 1608969. 
  40. Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y (April 1990). «Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae». J Biol Chem 265 (12):  pp. 6726-33. PMID 2139027. 
  41. Perler FB (January 2002). «InBase: the Intein Database». Nucleic Acids Res 30 (1):  pp. 383-4. PMID 11752343. 

Véase también[editar]