Leishmania

De Wikipedia, la enciclopedia libre
Ir a la navegación Ir a la búsqueda
Symbol question.svg
 
Leishmania
Leishmania donovani 01.png
L. donovanii
Taxonomía
Reino: Protista
Filo: Euglenozoa
Clase: Kinetoplastea
Orden: Trypanosomatida
Familia: Trypanosomatidae
Género: Leishmania
Especies

Leishmania es un género de protistas responsable de la enfermedad conocida como leishmaniasis,[1]​ o leishmaniosis. El principal vector de infección son los mosquitos de los géneros Phlebotomus (en Eurasia y África) y Lutzomyia (en América). Sus víctimas son vertebrados: la leishmaniasis afecta a marsupiales, cánidos, roedores y primates. Se estima que unos 12 millones de humanos padecen leishmaniasis hoy en día.

Historia[editar]

Los orígenes de la Leishmania no son claros.[2][3]​ Una teoría propone un origen en África, con migración a las Américas desde el Viejo Mundo unos 15 millones de años a través del estrecho de Bering. Otra teoría propone un origen paleártico.[4]​ Dichas migraciones incluirían migraciones de los vectores o adaptaciones sucesivas. Una migración más reciente es la de L. infantum desde el Mediterráneo hasta países latinoamericanos, llamada desde entonces L. chagasi, desde la colonización europea del Nuevo Mundo, donde los parásitos encontraron un insecto vector que posibilitó su propagación a la población autóctona.

La primera descripción de leishmaniasis fue hecha por El-Razy de Iraq, alrededor del año 1500 d. C. En 1898, el médico ruso Piotr F. Borovsky hizo la primera descripción del agente etiológico presente en las lesiones cutáneas de un paciente, pero su publicación, hecha en ruso, pasó prácticamente inadvertida por los científicos occidentales.

En 1901, William Boog Leishman, durante el examen de muestras patológicas del bazo de un paciente que había muerto de leishmaniasis (kala azar) se observaron cuerpos ovales y publicó acerca de ellos en 1903. Charles Donovan del Indial Medical Service Independent encontró que dichas entidades se hallaban en otros pacientes de kala azar; ahora se conocen como cuerpos de Leishman-Donovan. Lo identificaron como el protozoo que causa el kala azar, Leishmania donovani. Sinónimos para el kala azar incluyen ahora la leishmaniasis. Nombre de Leishman fue grabado en la historia de la parasitología por Sir Ronald Ross , quien quedó impresionado por el trabajo de Leishman y clasificó el agente etiológico de kala azar diferenciándolo en género Leishmania.

Formas del parásito y su morfología[editar]

Formas celulares de los Trypanosomatida.
Amastigotes de Leishmania infantum en macrófagos

Los parásitos del género Leishmania adoptan dos formas morfológicas durante su ciclo de vida:

  • Promastigote, forma alargada con un flagelo anterior, que se multiplican de forma extracelular en el intestino del invertebrado vector.
  • Amastigote, forma esférica con un flagelo muy corto que no sobresale de la bolsa flagelar, de modo que sólo es apreciable en el microscopio eléctrónico. Se multiplica dentro de macrófagos y células del sistema retículoendotelial del huésped vertebrado.

Aunque a primera vista las formas promastigote y amastigote parecen ser muy diferentes, la estructura celular está muy conservada. Por delante del núcleo se encuentra el kinetoplasto, que es una región de la mitocondria donde se localiza el DNA mitocondrial formado por miles de moléculas circulares concatenadas. El kinetoplasto está conectado con el cuerpo basal del que emerge el flagelo. En la base de flagelo se encuentra una invaginación de la membrana celular que recibe el nombre de bolsillo flagelar, lugar especializado en los procesos de endocitosis y exocitosis y que está conectado con el aparato de Golgi.

           En el insecto vector, se han descrito varios estadios del parásito. Así, en la ingesta de sangre desde un hospedador infectado con Leishmania, macrófagos con amastigotes en su interior son ingeridos y, tras la lisis del macrófago, los amastigotes se diferencian en promastigotes procíclicos. A continuación, estos se transforman en promastigotes nectomonados (nectomonads), que escapan de la matriz peritrófica y se adhieren a las microvellosidades de las células del epitelio intestinal. Este anclaje resulta fundamental para evitar que el parásito sea expulsado junto con los restos no adsorbidos tras la digestión de la ingesta de sangre. Posteriormente avanzan hacia el intestino torácico y a la válvula estomodeal, donde se diferencian en promastigotes lectomonados (leptomonads). Allí, los lectomonados se diferencian bien en promastigotes haptomonados (haptomonads), que se adhieren a la válvula estomodeal, o en promastigotes metacíclicos, que son las formas infectivas y que son transmitidos a los hospedadores mamíferos cuando el insecto pica para ingerir sangre. El fuerte anclaje de los haptomonados a la estructura quitinosa de la válvula estomodeal impide que pasen junto a los metacíclicos al hospedador mamífero, y de esta manera podrían ser también los responsables de que el insecto vector permanezca infectado de por vida.

           Las distintas formas de promastigotes se definen en base a características morfológicas y de tamaño. Así, los promastigotes procíclicos tienen una longitud del cuerpo entre 6,5 y 11,5 µm, y un flagelo más corto que el cuerpo; el cuerpo de los nectomonados tiene una longitud mayor a 12 µm; los leptomonados tienen una longitud del cuerpo entre 6,5 y 11,5 µm, pero un flagelo más largo que el cuerpo; los promastigotes metacíclicos tienen una longitud del cuerpo inferior a 8 µm (anchura de 1 µm) y un flagelo más largo que el cuerpo [5]​.

Localización evolutiva (Filogenia)[editar]

Los parásitos del género Leishmania pertenecen al orden de los tripanosomátidos,[6]​ donde se encuadran otros agentes etiológicos de enfermedades tan importantes como son la enfermedad del sueño (causada por Trypanosoma brucei) y la enfermedad de Chagas (causada por Trypanosoma cruzi). Todos ellos presentan ciclos de vida complejos en el que intervienen dos tipos de hospedadores, mamíferos e insectos. En la escala evolutiva se sitúan en una de las ramas surgidas más tempranamente del tronco evolutivo de los eucariotas (hace unos 500 millones de años), lo que explica que estos organismos tengan mecanismos moleculares bastante peculiares, entre los que destacan la extensa edición del RNA mitocondrial para generar mRNAs funcionales a partir de los transcriptos derivados de criptogenes (o pseudogenes) mitocondriales, la transcripción policistrónica de los genes nucleares y el procesamiento de los mRNAs mediante el mecanismo de trans-splicing.

Taxonomía[editar]

La clasificación de los parásitos del género Leishmania se basó inicialmente en criterios clínicos, de acuerdo a la enfermedad generada en los pacientes. Así, a las leishmanias causantes de leishmaniasis cutáneas, independientemente del lugar geográfico, se les denomino Leishmania tropica, y a las causantes de leishmaniasis visceral (LV) como Leishmania donovani. En 1908, el médico francés Charles Nicolle, teniendo en cuenta las peculiaridades de la LV en personas de la cuenca mediterránea, cuyas características clínicas y epidemiológicas eran diferentes a las asociadas a la LV en la India, decidió nombrar como Leishmania infantum al parásito causante de la LV en la zona mediterránea y mantener la denominación de L. donovani a los parásitos causantes de LV en la India. Posteriormente, en 1911, el científico brasileño Gaspar Vianna consideró pertinente nominar una nueva especie, Leishmania braziliensis, como la causante de las formas diseminadas de leishmaniasis que aparecían con cierta frecuencia en pacientes de Brasil. En años sucesivos, un gran número de especies se fueron nombrando, donde los criterios de localización geográfica se fueron imponiendo a los criterios clínicos, lo que ha llevado a la situación actual en la que organismos genéticamente indistinguibles recibieron nombres diferentes. Estudios filogenéticos basados en análisis de secuencias nucleotídicas están ayudando al establecimiento de taxonomías dentro del género Leishmania cada vez más consistentes [7]​.

Ciclo de vida[editar]

Ciclo vital de Leishmania.
  • Etapas en el ser humano. La leishmaniasis es transmitida por la picadura de un insecto hematófago. El insecto inyecta en la sangre la forma infecciosa, los promastigotes (1 en la figura). Los promastigotes son fagocitados por los macrófagos (2) y se transforman en amastigotes (3). Estos se multiplican en las células infectadas y afectan a distintos tejidos, dependiendo en parte de la especie de Leishmania (4). Esto origina las manifestaciones clínicas de la leishmaniasis.
  • Etapas en el insecto. El insecto se infecta al ingerir sangre con macrófagos infectados por amastigotes (5, 6). En el intestino del insecto, los parásitos se diferencian en promastigotes (7), que se multiplican y migran a la probóscide (8). Si el insecto realiza otra picadura, los promastigotes pasan a la sangre del huésped (1), completándose el ciclo.

Epidemiología[editar]

Las infecciones se consideran cutáneas, mucocutáneas o viscerales.

Las infecciones cutáneas, localizadas y difusas son claras infecciones de la piel. La más común es el botón de Oriente (causada por las especies del Viejo Mundo L. major, L. tropica, y L. aethiopica). En el Nuevo Mundo, los culpables más comunes son la L. mexicana y L. (Viannia) braziliensis. Las infecciones cutáneas son más frecuentes en Afganistán, Brasil, Irán, Perú, Arabia Saudita y Siria. La versión mucocutánea (espundia) son infecciones que comienzan como una reacción a la picadura y luego dispersan a las membranas mucosas y pueden llegar a ser mortales. Las infecciones mucocutáneas son frecuentes en Bolivia, Brasil y Perú.

Las infecciones viscerales se reconocen por la fiebre, hepato-esplenomegalia y anemia. Se conocen por varios nombres, el más común de los cuales es Kala azar,[8][9]​ y es causada exclusivamente por el complejo L. donovani (L. donovani, L. infantum, L. chagasi).[1]​ Se halla en áreas tropicales y subtropicales en todos los continentes, con la excepción de Oceania, especialmente en Bangladés, Brasil, India, Nepal y Sudán.[1]

Patogenia[editar]

Lo primero que ocurre es la penetración de los parásitos al hombre. Los promastigotas metacíclicos muestran resistencia a la citólisis por el complemento, debido a las modificaciones en la lipofosfoglicano (LPG) componente mayoritario de la superficie de la Leishmania. Posteriormente, se produce la unión macrófago-parásito en las que intervienen varias proteínas de superficie que favorecen la opsonización de los promastigotas y su unión a los receptores de macrófagos. Una vez adherido los promastigotas se produce la fagocitosis y se produce la transformación en amastigotas. Los amastigotas logran multiplicarse en el interior del macrófago, lo que conlleva a la lisis del macrófago y la liberación de parásitos que infectan nuevos macrófagos. La respuesta del huésped determina la progresión o eliminación de la infección, respuesta mediada principalmente por células T.

Proteína Kinasa R[editar]

Los macrófagos infectados por multitud de parásitos tienen como fuente de protección común la producción de óxido nítrico producido por la Óxido nítrico sintasa que es regulada a través del factor NF-kapabeta (factor nuclear potenciador de las cadenas ligeras kappa de las células B activadas).

En el caso de Leishmania se pierde esa forma de defensa debido a que el parásito fosforila la PKR (proteína kinasa R dependiente de ARN de doble cadena) que es un componente clave en la respuesta antiviral celular. Esta proteína activada desacopla las subunidades de Nf-kapabeta inhibiendo la Óxido nítrico sintasa. La activación de PKR puede deberse a múltiples factores: intermediarios de ARN de doble cadena, estímulos como el factor de necrosis tumoral (TNF), Interleukinas (IL) y el lipopolisacárido bacteriano (LPS). PKR juega un papel fundamental en la ruta de señalización innata ya que es activada por la respuesta proinflamatoria además de ser importante en la activación del Factor Nuclear B (NF-B).

Se ha comprobado que la infección producida por la especie L. amazonensis induce la fosforilación de PKR y aumenta su concentración. Cuando PKR está activa induce la producción de IL-10 que es un clásico supresor de citoquinas que puede favorecer la proliferación intracelular de L.amazonensis. El tratamiento con Poly C (polirribonucleótido sintético inductor de PKR) también produce la fosforilación de PKR y aumenta su concentración.[10]

La activación de PKR puede inducir al dímero transactivador de Nf-kapaBeta que conduce a la expresión de la Óxido nítrico sintasa y como consecuencia producirse NO, el cual presenta un efecto negativo a la proliferación intracelular de Leishmania. Sin embargo, L. amazonensis es capaz de inducir el represor del homodímero NFKB y la división de la subunidad transactivadora P65Nf-kapaBeta ocasionando la supresión de la producción de Óxido nitríco sintasa y por ende la reducción de los niveles intracelulares de NO. La activación de PKR por el Poly C induce la producción de IL-10 presentando un efecto positivo en la proliferación intracelular de Leishmania.[10]

Una posible vía de acción terapéutica podría consistir en utilizar PKR como biomarcador de Leishmania y desarrollar fármacos que actúen sobre la proteína.

Genoma[editar]

El genoma de los parásitos del género Leishmania está constituido por 34 a 36 cromosomas, dependiendo de la especie. La mayoría de las especies, denominadas del Viejo Mundo, (L. donovani, L. infantum, L. chagasi, L. major y otras) cuanta con 36 cromosomas, mientras que las especies del Nuevo Mundo, L. braziliensis y L. mexicana cuentan con 35 y 34 cromosomas respectivamente. En el genoma de L. braziliensis, los cromosomas 20 y 34 se encuentran fusionados mientras que en el genoma de L. mexicana se encuentran fusionados los cromosomas 8 - 29 y 20 - 36.[11][12]

Una de las peculiaridades del genoma en Leishmania, y otros tripanosomátidos relacionados como son Trypanosoma brucei y Trypanosoma cruzi, es la organización de sus genes en largas agrupaciones con igual orientación transcripcional. Los genes que componen estas agrupaciones no parecen tener ninguna relación funcional, más bien su ordenación unidireccional parece ser dictada por el modo en el que son transcritos. Los trabajos realizados por el investigador mexicana Santiago Martínez-Calvillo y el estadounidense Peter Myler demostraron que la transcripción de los genes se inicia justo por encima del primer gen de cada agrupación y procede de forma policistrónica hasta alcanzar el último gen[13]​. Estas agrupaciones génicas se denominan unidades de transcripción policistrónica (PTUs, del inglés Polycistronic Transcription Units). Algunas regiones de los cromosomas, conocidas como regiones de cambio de hebra (SSRs, del inglés Strand-Switch Regions), la transcripción de las PTUs comienza bidireccionalmente (y se denominan SSRs divergentes) o la transcripción de dos PTUs localizadas en hebras opuestas converge (SSRs convergentes) y presumiblemente termina. En la siguiente figura se ilustra cómo es la organización génica en Leishmania.

Organización génica en Leishmania.

Aunque Leishmania es considerado como un organismo esencialmente diploide, esta no es una característica genómica que este parásito controle de forma estricta. Más bien, una aneuploidía cromosomal parece ser más la norma, y esta puede ser distinta de acuerdo con las especies (e incluso entre cepas de la misma especie) y además puede cambiar de acuerdo con las condiciones ambientales en las que se encuentre el parásito. Aún es más, de acuerdo con los minuciosos trabajos realizados por los investigadores Patrick Bastien, Michel Pagès e Yvon Sterkers de la Universidad de Montpellier, los parásitos que forman una población derivada de una cepa (o incluso un clon) contienen genomas diferentes en cuanto al número de cada uno de sus cromosomas. Así, la población está compuesta por parásitos que contienen uno, dos, tres o más copias de cada uno de los cromosomas, y que las proporciones de estas células puede ser distinta en las cepas o variar con las condiciones ambientales en las que la población esté creciendo. A esta sorprendente característica de Leishmania, estos autores la han llamado mosaic aneuploidy[14]​, que podríamos traducirla como mosaico de aneuploidías.

Transcripción poliscistrónica y generación de los mRNAs[editar]

Leishmania, y otros tripanosomátidos con los que comparte una similar organización genómica, tiene una forma muy peculiar de regular la expresión génica. No existe control (o es poco significativo) a nivel génico de la transcripción, sino que los genes (organizados en largas agrupaciones, como se indica en el apartado sobre su genoma) se transcriben continuamente en unidades policistrónicas [15]​. Según están siendo sintetizados por la RNA polimerasa II, estos transcritos son procesados para generar RNAs mensajeros individuales (mRNAs) mediante otro peculiar mecanismo presente en estos microorganismos, el trans-splicing o proceso de unión de dos moléculas de RNA no colineales. Este peculiar mecanismo fue descrito inicialmente en el laboratorio dirigido por la investigadora estadounidense Nina Agabian en los años 80 del siglo pasado [16]​, pero luego, con los años, se fue encontrando en diversos grupos de organismos, tales como cnidarios, nematodos, crustáceos, rotíferos y dinoflagelados, entre otros [17]​. Durante el trans-splicing en Leishmania, una secuencia de 39 nucleótidos, conocida como mini-exón o secuencia SL (del inglés spliced leader) es añadida al comienzo de todos los RNAs codificantes de proteínas, definiendo el extremo 5’ de los mRNAs. El extremo 3’ de los mRNAs, como en el resto de los eucariotas, incluye una hilera de adeninas, introducidas tras el procesamiento del transcrito precursor. Ambos procesos, trans-splicing de un transcrito y la poliadenilación del transcrito situado por encima en el precursor ocurren de manera concertada [18]​.

           La secuencia del mini-exón (AACUAACGCUAUAUAAGUAUCAGUUUCUGUACUUUAUUG) es idéntica en todas las especies del género Leishmania, y deriva de un transcrito precursor conocido como medRNA, que empieza con dicha secuencia mini-exón. El extremo 5’ del mRNA (y en consecuencia del mini-exón) se encuentra muy modificado, el primer nucleótido está modificado con la adición de 7-metilguanina (modificación típica del 5’ de los mRNAs eucarióticos), pero además los cuatro primeros nucleótidos (AACU) están modificados por O-metilación en posición 2’ del anillo de ribosa, además de metilaciones adicionales en el primer y cuarto nucleótidos. Todas estas modificaciones ocurren durante la biogénesis del medRNA. Por estas peculiaridades, a esta estructura se le denomina cap4, y como ocurre con la estructura cap de los mRNAs eucarióticos, su presencia es un requisito para la traducción en los ribosomas [19]​.

En la siguiente figura se ilustran los procesos indicados.

Modelo sobre la transcripción policistrónica en Leishmania, y el procesamiento mediante el mecanismo de trans-splicing (adición de un pequeño exón, denominado miniexón o SL) y la poliadenilación, para dar lugar a mensajeros individuales maduros

Enlaces externos[editar]

  • Microbiología clínica (on-line). Capítulo 27. Género Leishmania

Referencias[editar]

  1. a b c Ryan KJ; Ray CG (editors) (2004). Sherris Medical Microbiology (4th ed. edición). McGraw Hill. pp. 749-54. ISBN 0838585299. 
  2. Momen H, Cupolillo E (2000). «Speculations on the origin and evolution of the genus Leishmania». Mem. Inst. Oswaldo Cruz 95 (4): 583-8. PMID 10904419. 
  3. Noyes HA, Moro DA, Chance ML, Ellis JT (2000). «Evidence for a neotropical origin of Leishmania». Mem. Inst. Oswaldo Cruz 95 (4): 575-8. PMID 10904417. 
  4. Kerr SF (1995). «Palaearctic origin of Leishmania». Mem. Inst. Oswaldo Cruz 95 (1): 75-80. PMID 10656708. 
  5. Sunter J, Gull K. 2017. Shape, form, function and Leishmania pathogenicity: from textbook descriptions to biological understanding. Open Biol 7: 170165. PMID=28903998
  6. Moreira D, Lopez-Garcia P, Vickerman K. 2004. An updated view of kinetoplastid phylogeny using environmental sequences and a closer outgroup: proposal for a new classification of the class Kinetoplastea. Int J Syst Evol Microbiol 54: 1861-1875.[1]
  7. Fraga J, Montalvo AM, Van der Auwera G, Maes I, Dujardin JC, Requena JM. 2013. Evolution and species discrimination according to the Leishmania heat-shock protein 20 gene. Infect Genet Evol 18: 229-237. [2]
  8. Visceral leishmniasis: The disease
  9. kala-azar
  10. a b Pereira, R. M.; Teixeira, K. L.; Barreto-de-Souza, V.; Calegari-Silva, T. C.; De-Melo, L. D.; Soares, D. C.; et al (febrero de 2010). «Novel role for the double-stranded RNA-activated protein kinase PKR: modulation of macrophage infection by the protozoan parasite Leishmania.» [Novedoso rol de la proteina quinasa PKR de doble hebra activada por ARN: modulación de la infección de macrófagos por el protozoo parásito Leishmania]. FASEB J (en inglés) 24 (2): 617-626. PMID 19812373. doi:10.1096/fj.09-140053. Consultado el 24 de septiembre de 2017. 
  11. Myler, Peter J.; Beverley, Stephen M.; Cruz, Angela K.; Dobson, Deborah E.; Ivens, Alasdair C.; Saxena, Alka; et al (agosto de 2001). «The Leishmania genome project: new insights into gene organization and function» [Proyecto genoma Leishmania: nuevos entendimientos acerca de la organización del genoma y función]. Med Microbiol Immunol 2001) 190: 9±12 DOI (en inglés) 190: 9-12. doi:10.1007/s004300100070. Consultado el 19 de noviembre de 2017. 
  12. Britto, C.; Ravel, C.; Bastien, P.; Blaineau, C.; Pagès, M.; Dedet, J. P.; Wincker, P. (noviembre de 1998). «Conserved linkage groups associated with large-scale chromosomal rearrangements between Old World and New World Leishmania genomes» [Grupos de encadenamiento conservado asociados con reordenamientos cromosómicos de gran escala entre los genomas de Leishmania del Viejo Mundo y el Nuevo Mundo]. Gene (en inglés) 222 (1): 107-117. PMID 9813266. Consultado el 24 de septiembre de 2017. 
  13. Martinez-Calvillo S, Yan S, Nguyen D, Fox M, Stuart K, Myler PJ. 2003. Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol Cell 11: 1291-1299. PMID=12769852
  14. Lachaud, L., Bourgeois, N., Kuk, N., Morelle, C., Crobu, L., Merlin, G., Bastien, P., Pages, M., and Sterkers, Y. (2014). Constitutive mosaic aneuploidy is a unique genetic feature widespread in the Leishmania genus. Microbes Infect 16, 61-66. PUBMED: 24120456
  15. Requena JM. 2011. Lights and shadows on gene organization and regulation of gene expression in Leishmania. Front Biosci 17: 2069-2085. PMID=21622163
  16. Parsons M, Nelson RG, Watkins KP, Agabian N. 1984. Trypanosome mRNAs share a common 5' spliced leader sequence. Cell 38: 309-316. PMID=6088073
  17. Lasda EL, Blumenthal T. 2011. Trans-splicing. Wiley Interdiscip Rev RNA 2: 417-434. PMID=21957027
  18. LeBowitz JH, Smith HQ, Rusche L, Beverley SM. 1993. Coupling of poly(A) site selection and trans-splicing in Leishmania. Genes Dev 7: 996-1007. PMID=8504937
  19. Freire ER, Sturm NR, Campbell DA, de Melo Neto OP. 2017. The Role of Cytoplasmic mRNA Cap-Binding Protein Complexes in Trypanosoma brucei and Other Trypanosomatids. Pathogens 6: 55. PMID=29077018