Haplogrupo I-M253

De Wikipedia, la enciclopedia libre
Saltar a: navegación, búsqueda

El haplogrupo I-M253, también conocido como I1, es un haplogrupo del cromosoma Y. Los marcadores genéticos confirmados como identificativos de I-M253 son los SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, Oficial L 124/S64, L125/S65, L157.1, L186, y L187. Es una rama primaria del Haplogrupo I-M170 (I*).

El haplogrupo alcanza sus frecuencias más altas en Suecia (52% de los varones del Condado de Västra Götaland ) y Finlandia occidental (más del 50 % en la provincia de Satakunta).[1]​ En términos de medias nacionales, I-M253 se encuentra en el 35–38% de los hombres suecos, el 32.8% de los hombres daneses, aproximadamente el 31.5% de los hombres noruegos, y aproximadamente el 28% de los varones finlandeses.[2][3][4]

El haplogrupo I-M253 es una rama primaria del haplogrupo I* (I-M170), que viene estando presente en Europa desde la antigüedad. La otra rama primaria de la I* es I-M438, también conocida como I2.

Antes de una reclasificación en 2008,[5]​ el grupo era conocido como I1a, un nombre que desde entonces ha sido reasignado a otra rama primaria, el haplogrupo I-DF29. Las otras ramas primarias de I1 (M253) son el i1b (S249/Z131) y I1c (Y18119/Z17925).

Origen[editar]

Según un estudio publicado en 2010, I-M253 se originó entre hace de 3.170 a 5.000 años, en el Calcolítico Europeo.[6]​ Un nuevo estudio, en el 2015, estimó el origen entre 3.470 y 5.070 años atrás o entre 3.180 y 3.760 años, utilizando dos técnicas diferentes.[7]​ Se sugiere que inicialmente se dispersó desde el área que ahora es Dinamarca.[8]

Un estudio de 2014 en Hungría reveló restos de nueve individuos de la Cultura de la cerámica de bandas, en uno de los cuales se encontró el SNP M253 que define el Haplogrupo I1. Esta cultura se cree haber estado presente entre 6.500 y 7.500 años atrás.[9]

Estructura[editar]

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) o I1 [10]

  • I-DF29 (DF29/S438); I1a
    • I-CTS6364 (CTS6364/Z2336); I1a1
      • I-M227; I1a1a
      • I-L22 (L22/S142); I1a1b
        • I-P109; I1a1b1
        • I-L205 (L205.1/L939.1/S239.1); I1a1b2
        • I-Z74; I1a1b3
        • I-L300 (L300/S241); I1a1b4
          • I-L287
            • I-L258 (L258/S335)
          • I-L813
    • I-Z58 (S244/Z58); I1a2
      • I-Z59 (S246/Z59); I1a2a
        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
          • I-Z140 (Z140, Z141)
            • I-L338
            • I-F2642 (F2642)
          • I-Z73
            • I-L1302
          • I-L573
          • I-L803
        • I-Z382; I1a2a2
      • I-Z138 (S296/Z138, Z139); I1a2b
        • I-Z2541
    • I-Z63 (S243/Z63); I1a3
      • I-BY151; I1a3a
        • I-L849.2; I1a3a1
        • I-BY351; I1a3a2
            • I-CTS10345
              • I-Y10994
            • I-Y7075
        • I-S2078
          • I-S2077
            • I-Y2245 (Y2245/PR683)
              • I-L1237
                • I-FGC9550
              • I-S10360
                • I-S15301
              • I-Y7234
        • I-BY62 (BY62); I1a3a3
  • I-Z131 (Z131/S249); I1b
    • I-CTS6397; I1b1
  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Distribución geográfica[editar]

I-M253 encuentra su mayor densidad en el Norte de Europa y en otros países que experimentaron gran migración desde el Norte de Europa, ya sea en el Período de Migración, el periodo Vikingo, o en tiempos modernos. Se encuentra en todos los lugares invadidos por los antiguos pueblos Germánicos y por los Vikingos.

Durante la época moderna, poblaciones significativas de I-M253 también han echado raíces en naciones de inmigrantes y ex colonias europeas tales como los Estados unidos, Australia y Canadá.

Población Tamaño de la muestra I (total) I1 (I-M253) I1a1a (I-M227) Fuente
Austria 43 9.3 2.3 0.0 Underhill Et al. 2007
Bielorrusia: Vitebsk 100 15 1.0 0.0 Underhill Et al. 2007
Bielorrusia: Brest 97 20.6 1.0 0.0 Underhill Et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi Et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak Et al. 2013
República Checa 47 31.9 8.5 0.0 Underhill Et al. 2007
República Checa 53 17.0 1.9 0.0 Rootsi Et al. 2004
Dinamarca 122 39.3 32.8 0.0 Underhill Et al. 2007
Inglaterra 104 19.2 15.4 0.0 Underhill Et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi Et al. 2004
Estonia 118 11.9 Lappalainen Et al. 2008
Finlandia (nacional) 28.0 Lappalainen Et al. 2006
Finlandia: occidental 230 40 Lappalainen Et al. 2008
Finlandia: oriental 306 19 Lappalainen Et al. 2008
Finlandia: Satakunta región 50+ Lappalainen Et al. 20089
Francia 58 17.2 8.6 1.7 Underhill Et al. 2007
Francia 12 16.7 16.7 0.0 Cann Et al. 2002
Francia (Normandía Baja) 42 21.4 11.9 0.0 Rootsi Et al. 2004
Alemania 125 24 15.2 0.0 Underhill Et al. 2007
Grecia 171 15.8 2.3 0.0 Underhill Et al. 2007
Hungría 113 25.7 13.3 0.0 Rootsi Et al. 2004
Irlanda 100 11 6.0 0.0 Underhill Et al. 2007
Tártaros de Kazán 53 13.2 11.3 0.0 Trofimova 2015
Letonia 113 3.5 Lappalainen Et al. 2008
Lituania 164 4.9 Lappalainen Et al. 2008
Países bajos 93 20.4 14 0.0 Underhill Et al. 2007
Noruega 2826 31.5 Eupedia 2017Plantilla:Better source
Rusia (nacional) 16 25 12.5 0.0 Cann Et al. 2002
Rusia: Pskov 130 16.9 5.4 0.0 Underhill Et al. 2007
Rusia: Kostroma 53 26.4 11.3 0.0 Underhill Et al. 2007
Rusia: Smolensk 103 12.6 1.9 0.0 Underhill Et al. 2007
Rusia: Voronez 96 19.8 3.1 0.0 Underhill Et al. 2007
Rusia: Arkhangelsk 145 15.8 7.6 0.0 Underhill Et al. 2007
Rusia: Cosacos 89 24.7 4.5 0.0 Underhill Et al. 2007
Rusia: Carelios 140 10 8.6 0.0 Underhill Et al. 2007
Rusia: Carelios 132 15.2 Lappalainen Et al. 2008
Rusia: Vepsos 39 5.1 2.6 0.0 Underhill Et al. 2007
Eslovaquia 70 14.3 4.3 0.0 Rootsi Et al. 2004
Eslovenia 95 26.3 7.4 0.0 Underhill Et al. 2007
Suecia (nacional) 160 35.6 Lappalainen Et al. 2008
Suecia (nacional) 38.0 Lappalainen Et al. 2009
Suecia: Västra Götaland 52 Lappalainen Et al. 2009
Suiza 144 7.6 5.6 0.0 Rootsi Et al. 2004
Turquía 523 5.4 1.1 0.0 Underhill Et al. 2007
Ucrania: Lvov 101 23.8 4.9 0.0 Underhill Et al. 2007
Ucrania: Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill Et al. 2007
Ucrania: Hmelnitz 176 26.2 6.1 0.0 Underhill Et al. 2007
Ucrania: Cherkassy 114 28.1 4.3 0.0 Underhill Et al. 2007
Ucrania: Belgorod 56 26.8 5.3 0.0 Underhill Et al. 2007

Suecia[editar]

Dinamarca[editar]

Noruega[editar]

Finlandia[editar]

Gran Bretaña[editar]

Mapa que muestra la distribución de los cromosomas Y en una transección de Inglaterra y Gales del trabajo "Pruebas objetivas del cromosoma Y en la invasión masiva anglo-sajona". Los autores atribuyen las diferencias en las frecuencias del haplogrupo I anglo-sajón en la migración masiva a Inglaterra, pero no al país de Gales.

En 2002 un trabajo publicado por Michael E. Weale y colegas muestra evidencia genética de diferencias de población entre las poblaciones inglesas y galesas, incluyendo un llamativo nivel más alto de haplogrupo ADN-Y I en Inglaterra que en Gales. Lo vieron como evidencia convincente de la invasión en masa anglosajona de la Gran Bretaña oriental desde Dinamarca y Alemania del norte durante el Periodo de Migración.[11]​ Los autores supusieron el origen de poblaciones con proporciones grandes del haplogrupo I en Alemania del norte o Escandinavia del sur, particularmente Dinamarca, y que sus antepasados habrían emigrado a través del Mar Del Norte con las migraciones anglosajonas y vikingos daneses. La reivindicación principal de los investigadores era

que habría sido necesaria una efemérides de inmigración anglosajona que hubiese afectado al 50–100% del patrimonio genético de los hombres de la Inglaterra central en aquel tiempo. Observamos, aun así, que nuestros datos no nos permiten distinguir un acontecimiento simplemente añadido al patrimonio genético de los hombres nativos de la Inglaterra central de otro dónde los varones nativos hubiesen sido desplazados a otro lugar o uno dónde se hubiese reducido en número a los hombres nativos … Este estudio muestra que la frontera galesa fue más una barrera genética para el flujo de gen del cromosoma anglosajón Y que el Mar Del norte … Estos resultados indican que una frontera política puede ser más importante que una geofísica en la estructuración genética de la población.

Distribución de los haplogrupos del cromosoma Y de Capelli et al. (2003). El haplogrupo I está presente en todas las poblaciones, con las frecuencias más altas en el este y las frecuencias más bajas en el oeste. Parece ser que no hay límite discontinuo como se observa en la Weale et al. (2002)

En 2003, un artículo fue publicado por Christian Capelli y colegas que apoyaron, pero modificadas, las conclusiones de Weale y colegas.[12]​ En esta ponencia, que muestrea Gran Bretaña e Irlanda en en cuadrícula, se encontró una menor diferencia entre las muestras galesa e inglesa, con una disminución gradual de la frecuencia del haplogrupo I moviéndose hacia el oeste, en el sur de Gran Bretaña. Los resultados sugieren a los autores que invasores vikingos noruegos habrían influenciado fuertemente la zona norte de las Islas Británicas, pero que tanto las muestras inglesas como las escocesas de la isla principal ( Gran Bretaña) ambas tienen influencia alemana/danesa.

Miembros destacados de I-M253[editar]

Alexander Hamilton, a través de la genealogía y test de sus descendientes (suponiendo real la paternidad coincidente con su genealogía), que ha sido identificado dentro del haplogrupo ADN-Y I-M253.[13]

Birger Jarl, 'Duque de Suecia' de la Casa de los Godos de Bjalbo, fundador de Estocolmo, se le analizaron los restos inhumados en una iglesia en 2002 y se comprobó ser I-M253

Los pasajeros Mayflower William Brewster, Edward Winslow y George Soule a través de pruebas de ADN

Marcadores[editar]

ADN ejemplo: la cadena 1 difiere de la cadena 2 en la ubicación de un único par de bases (polimorfismo C >> T ).

Las siguientes son las especificaciones técnicas para las mutaciones conocidas de SNP y STR del haplogrupo I-M253.

Nombre: M253[14]

Tipo: SNP
Fuente: M (Peter Underhill de la Universidad de Stanford)
Posición: ChrY:13532101..13532101 (+ cadena)
Posición (par de bases): 283
Tamaño Total (pares de bases): 400
Longitud: 1
ISOGG HG: I1
Imprimación F (Directa 5'→ 3'): GCAACAATGAGGGTTTTTTTG
Imprimación R (Inversa 5'→ 3'): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Cambio de los alelos de nucleótido (mutación): C por T

Nombre: M307[15]

Tipo: SNP
Fuente: M (Peter Underhill)
Posición: ChrY:21160339..21160339 (+ cadena)
Longitud: 1
ISOGG HG: I1
Imprimación F: TTATTGGCATTTCAGGAAGTG
Imprimación R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Cambio de los alelos de nucleótido (mutación): G por A

Nombre: P30[16]

Tipo: SNP
Fuente: PS (Michael Hammer de la Universidad de Arizona y James F. Wilson, de la Universidad de Edimburgo)
Posición: ChrY:13006761..13006761 (+ cadena)
Longitud: 1
ISOGG HG: I1
Imprimación F: GGTGGGCTGTTTGAAAAAGA
Imprimación R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Cambio de los alelos de nucleótido (mutación): G por A
Región: ARSDP

Nombre: P40[17]

Tipo: SNP
Fuente: PS (Michael Hammer y James F. Wilson)
Posición: ChrY:12994402..12994402 (+ cadena)
Longitud: 1
ISOGG HG: I1
Imprimación F: GGAGAAAAGGTGAGAAACC
Imprimación R: GGACAAGGGGCAGATT
YCC HG: I1
Cambio de los alelos de nucleótido (mutación): C por T
Región: ARSDP

Referencias[editar]

  1. Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). «Migration Waves to the Baltic Sea Region». Annals of Human Genetics 72 (3): 337-348. PMID 18294359. doi:10.1111/j.1469-1809.2007.00429.x. 
  2. Lappalainen, T.; Hannelius, U.; Salmela, E.; von Döbeln, U.; Lindgren, C. M.; Huoponen, K.; Savontaus, M.-L.; Kere, J. et al. (2009). «Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis». Annals of Human Genetics 73 (1): 61-73. PMID 19040656. doi:10.1111/j.1469-1809.2008.00487.x. 
  3. Eupedia, "Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in percentage" (31 January 2017) .
  4. Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp.207-15.
  5. Karafet, Tatiana M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). «New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree». Genome Research 18 (5): 830-8. PMC 2336805. PMID 18385274. doi:10.1101/gr.7172008. 
  6. Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  7. «TMRCAs of major haplogroups in Europe estimated using two methods. : Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group». www.nature.com. Consultado el 19 de mayo de 2015. 
  8. Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42.
  9. Plantilla:Cite biorxiv
  10. ISOGG, Y-DNA Haplogroup I and its Subclades - 2017 (31 January 2017).
  11. Weale, Michael E.; Weiss, Deborah A.; Jager, Rolf F.; Bradman, Neil; Thomas, Mark G. (2002). «Y chromosome Evidence for Anglo-Saxon Mass Migration». Molecular Biology and Evolution 19 (7): 1008-1021. PMID 12082121. doi:10.1093/oxfordjournals.molbev.a004160. 
  12. Capelli, Cristian; Redhead, Nicola; Abernethy, Julia K.; Gratrix, Fiona; Wilson, James F.; Moen, Torolf; Hervig, Tor; Richards, Martin; Stumpf, Michael P.H. et al. et al. (2003). «A Y Chromosome Census of the British Isles» (PDF). Current Biology 13 (11): 979-984. PMID 12781138. doi:10.1016/S0960-9822(03)00373-7. 
  13. «Founding Father DNA». isogg.org. 
  14. snpdev. «Reference SNP (refSNP) Cluster Report: rs9341296». nih.gov. 
  15. snpdev. «Reference SNP (refSNP) Cluster Report: rs13447354». nih.gov. 
  16. P30 (enlace roto disponible en Internet Archive; véase el historial y la última versión).
  17. P40 (enlace roto disponible en Internet Archive; véase el historial y la última versión).

Proyectos[editar]

Bases de datos haplogrupo I
Bases de datos general de ADN-Y

Hay varias bases de datos de acceso públicas exhibiendo I-M253, incluyendo:

Haplogrupos del cromosoma Y humano

Adán cromosómico-Y
A
BT
B CT
DE CF
D E C F
G H IJK
IJ K-M9
I J LT K-M526
L T MS P NO
M S Q R N O
R1 R2
R1a R1b


  1. http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
  2. http://www.semargl.me/
  3. http://www.ysearch.org/
  4. http://www.yhrd.org/
  5. http://www.yfull.com/tree/I1/